Feature PRIBNOW_7502
Name
PRIBNOW_7502
Location
425469..425508 -
Type
PRIBNOW
Sequence
ATCAGAGCGTGGTATTAGAACAAAAGCAAATTAACATTTA
View
 MyGBrowser