Feature PRIBNOW_7501
Name
PRIBNOW_7501
Location
424237..424276 -
Type
PRIBNOW
Sequence
GTGCGCCAAAAGCTAATTAAAAAAGGTTTGTTATAGTAAT
View
 MyGBrowser