Feature PRIBNOW_7389
Name
PRIBNOW_7389
Location
85224..85263 -
Type
PRIBNOW
Sequence
AAGATTAAATTGGTAACCCAAACCGATAATATATAATTGA
View
 MyGBrowser