Feature PRIBNOW_7376
Name
PRIBNOW_7376
Location
65552..65591 -
Type
PRIBNOW
Sequence
GCATCACTTAAATGGGTGTAAATCACCTCATTAAAATAAG
View
 MyGBrowser