Feature PRIBNOW_7368
Name
PRIBNOW_7368
Location
41143..41182 -
Type
PRIBNOW
Sequence
GTTAGATAAAGCTATTACCTTTTCAGTTTTATAAGCTTTG
View
 MyGBrowser