Feature PRIBNOW_7363
Name
PRIBNOW_7363
Location
30401..30440 -
Type
PRIBNOW
Sequence
ACCATCGGTACTACCACTTGGTGTCCGGAAATATACTTTA
View
 MyGBrowser