Feature PRIBNOW_7204
Name
PRIBNOW_7204
Location
469316..469355 -
Type
PRIBNOW
Sequence
TCAAGCCATTTGAAATAAGTTTGGGGTTTGTTAGAATAAT
View
 MyGBrowser