Feature PRIBNOW_7189
Name
PRIBNOW_7189
Location
424237..424276 -
Type
PRIBNOW
Sequence
GTGCGCCAAAAGCTAATTAAAAAAGGTTTGTTATAGTAAT
View
 MyGBrowser