Feature PRIBNOW_7114
Name
PRIBNOW_7114
Location
163559..163598 -
Type
PRIBNOW
Sequence
GTTTTAATTTTTTGTGCTAAATTAGCAGGAATAAACTGTG
View
 MyGBrowser