Feature PRIBNOW_7100
Name
PRIBNOW_7100
Location
126567..126606 -
Type
PRIBNOW
Sequence
TCATTAGGAATTGATGTTTTATAAAGGAAAATAGTCTTAC
View
 MyGBrowser