Feature PRIBNOW_7093
Name
PRIBNOW_7093
Location
114876..114915 -
Type
PRIBNOW
Sequence
GGGACGTGGAGGTGTGGTATAACTTTGTTATTACATTCGG
View
 MyGBrowser