Feature PRIBNOW_7092
Name
PRIBNOW_7092
Location
113418..113457 -
Type
PRIBNOW
Sequence
AAATCCATAAATGCAAAAATCAAACCTAAGAAAAAATAGC
View
 MyGBrowser