Feature PRIBNOW_7079
Name
PRIBNOW_7079
Location
87998..88037 -
Type
PRIBNOW
Sequence
CACTTAAAGTGTTCTTTAAAAATGGCAAAATTAAAATGGA
View
 MyGBrowser