Feature PRIBNOW_7056
Name
PRIBNOW_7056
Location
41143..41182 -
Type
PRIBNOW
Sequence
GTTAGATAAAGCTATTACCTTTTCAGTTTTATAAGCTTTG
View
 MyGBrowser