Feature PRIBNOW_7052
Name
PRIBNOW_7052
Location
30727..30766 -
Type
PRIBNOW
Sequence
TACCAATCCCAGCAGCTAAGGCATCCGGTTTTAAGGTCGC
View
 MyGBrowser