Feature PRIBNOW_6925
Name
PRIBNOW_6925
Location
427641..427678 +
Type
PRIBNOW
Sequence
AACTATATCTGCGCAGCTCATAATTTTAGTATATTAAA
View
 MyGBrowser