Feature PRIBNOW_6906
Name
PRIBNOW_6906
Location
358201..358238 +
Type
PRIBNOW
Sequence
TATAAGCGCTAAAAATTAATTAGAGTTTGTAAAATATT
View
 MyGBrowser