Feature RNA_hairpin_6725
Name
RNA_hairpin_6725
Location
30056..30093 -
Type
RNA_hairpin
Sequence
AAGATTTCCTTGGTCACAAACATTGCTTGGGAAATCTT
Energy (kcal/mol)
-15.8221
Secondary Structure
View
 MyGBrowser