Feature RNA_hairpin_6719
Name
RNA_hairpin_6719
Location
36500..36534 -
Type
RNA_hairpin
Sequence
GCGCTGGCCTGGGTATGGTTGACCCAATTGTGCGC
Energy (kcal/mol)
-14.0122
Secondary Structure
View
 MyGBrowser