Feature RNA_hairpin_6718
Name
RNA_hairpin_6718
Location
37970..37989 -
Type
RNA_hairpin
Sequence
GGGGGATTATGATCTTCCCC
Energy (kcal/mol)
-10.2221
Secondary Structure
View
 MyGBrowser