Feature RNA_hairpin_6717
Name
RNA_hairpin_6717
Location
38339..38362 -
Type
RNA_hairpin
Sequence
GAGGTCGATGATGGGTATGACCTC
Energy (kcal/mol)
-10.2908
Secondary Structure
View
 MyGBrowser