Feature RNA_hairpin_6677
Name
RNA_hairpin_6677
Location
66951..66979 -
Type
RNA_hairpin
Sequence
GACATTAAGTTGATGATCGACTTGATGTT
Energy (kcal/mol)
-14.3
Secondary Structure
View
 MyGBrowser