Feature RNA_hairpin_6658
Name
RNA_hairpin_6658
Location
76023..76049 -
Type
RNA_hairpin
Sequence
CAGCAACATTTGCGGTTGGTGTTGCTG
Energy (kcal/mol)
-13.8095
Secondary Structure
View
 MyGBrowser