Feature RNA_hairpin_6645
Name
RNA_hairpin_6645
Location
83228..83276 -
Type
RNA_hairpin
Sequence
ATCGCTTCTTCAAAGGCCACTACTAGTTCATTGTCTTTGGAGAAGTGAT
Energy (kcal/mol)
-21.1187
Secondary Structure
View
 MyGBrowser