Feature RNA_hairpin_6644
Name
RNA_hairpin_6644
Location
83434..83456 -
Type
RNA_hairpin
Sequence
TGAATGGTGTGTGGTACCGTTCA
Energy (kcal/mol)
-9.3
Secondary Structure
View
 MyGBrowser