Feature RNA_hairpin_6643
Name
RNA_hairpin_6643
Location
84575..84600 -
Type
RNA_hairpin
Sequence
CTCAAAGCTAAGGTAAAAGCTTTGGG
Energy (kcal/mol)
-12.1221
Secondary Structure
View
 MyGBrowser