Feature RNA_hairpin_6637
Name
RNA_hairpin_6637
Location
88385..88405 -
Type
RNA_hairpin
Sequence
GTGCTTTCACAATTAAAGCAC
Energy (kcal/mol)
-8.60946
Secondary Structure
View
 MyGBrowser