Feature RNA_hairpin_6594
Name
RNA_hairpin_6594
Location
112741..112763 -
Type
RNA_hairpin
Sequence
TATTTGGTCATGTTGGCCAAATA
Energy (kcal/mol)
-12.3
Secondary Structure
View
 MyGBrowser