Feature RNA_hairpin_6593
Name
RNA_hairpin_6593
Location
114399..114432 -
Type
RNA_hairpin
Sequence
TCGAGCTTAAAGCCGGTGACGGCTTTGGGTCCGG
Energy (kcal/mol)
-19
Secondary Structure
View
 MyGBrowser