Feature RNA_hairpin_6592
Name
RNA_hairpin_6592
Location
114475..114494 -
Type
RNA_hairpin
Sequence
GTCGAATCGAGGGGTTCGAC
Energy (kcal/mol)
-11.6
Secondary Structure
View
 MyGBrowser