Feature RNA_hairpin_6589
Name
RNA_hairpin_6589
Location
115155..115190 -
Type
RNA_hairpin
Sequence
GTCGGCCACAACGTCAAGACCGGCGATGAGGTAGGC
Energy (kcal/mol)
-14.7204
Secondary Structure
View
 MyGBrowser