Feature RNA_hairpin_6586
Name
RNA_hairpin_6586
Location
115595..115616 -
Type
RNA_hairpin
Sequence
GGTGCGCGACGGCAAGCGCGCC
Energy (kcal/mol)
-13.1221
Secondary Structure
View
 MyGBrowser