Feature RNA_hairpin_6561
Name
RNA_hairpin_6561
Location
125524..125544 -
Type
RNA_hairpin
Sequence
GCACTGTTCAAAATATAGTGC
Energy (kcal/mol)
-9.16058
Secondary Structure
View
 MyGBrowser