Feature RNA_hairpin_6560
Name
RNA_hairpin_6560
Location
126902..126924 -
Type
RNA_hairpin
Sequence
CTGTATTTACCAGGTGCTGGCAG
Energy (kcal/mol)
-9.7
Secondary Structure
View
 MyGBrowser