Feature RNA_hairpin_6551
Name
RNA_hairpin_6551
Location
128543..128564 -
Type
RNA_hairpin
Sequence
GGCCGCTCAGGGCCGGGGGGCC
Energy (kcal/mol)
-10.8204
Secondary Structure
View
 MyGBrowser