Feature PRIBNOW_62
Name
PRIBNOW_62
Location
163561..163598 +
Type
PRIBNOW
Sequence
TCACAGTTTATTCCTGCTAATTTAGCACAAAAAATTAA
View
 MyGBrowser