Feature RNA_hairpin_5946
Name
RNA_hairpin_5946
Location
424080..424103 -
Type
RNA_hairpin
Sequence
GGATTGCGGTATGAAATGCACTCC
Energy (kcal/mol)
-10.6204
Secondary Structure
View
 MyGBrowser