Feature RNA_hairpin_5945
Name
RNA_hairpin_5945
Location
424862..424893 -
Type
RNA_hairpin
Sequence
GTGGTGGGGTGGATTTGAAGTTTCCCCATCAT
Energy (kcal/mol)
-15.2204
Secondary Structure
View
 MyGBrowser