Feature RNA_hairpin_5845
Name
RNA_hairpin_5845
Location
469170..469190 -
Type
RNA_hairpin
Sequence
TGGCGGTTGCAAATGCTGCCA
Energy (kcal/mol)
-9.46058
Secondary Structure
View
 MyGBrowser