Feature RNA_hairpin_5843
Name
RNA_hairpin_5843
Location
469277..469311 -
Type
RNA_hairpin
Sequence
CCTAGTTTTTTTAACTAAAAGTTGAGAAGGCTAGG
Energy (kcal/mol)
-20.9
Secondary Structure
View
 MyGBrowser