Feature PRIBNOW_44
Name
PRIBNOW_44
Location
112681..112718 +
Type
PRIBNOW
Sequence
AATTAGTTGTATTTTTCAGAAAGCTTAACTAAAATTCC
View
 MyGBrowser