Feature RNA_hairpin_4302
Name
RNA_hairpin_4302
Location
358494..358524 +
Type
RNA_hairpin
Sequence
GGTTGTCGTGAGTTCGAATCTCACTCCAGCC
Energy (kcal/mol)
-13.1095
Secondary Structure
View
 MyGBrowser