Feature RNA_hairpin_4301
Name
RNA_hairpin_4301
Location
358477..358497 +
Type
RNA_hairpin
Sequence
GACCCGGTTCATACCCGGGTT
Energy (kcal/mol)
-11.4095
Secondary Structure
View
 MyGBrowser