Feature RNA_hairpin_4300
Name
RNA_hairpin_4300
Location
358414..358442 +
Type
RNA_hairpin
Sequence
GGGGTCGCAGGTTCAAATCCTGTCTTCCC
Energy (kcal/mol)
-12.8595
Secondary Structure
View
 MyGBrowser