Feature RNA_hairpin_3800
Name
RNA_hairpin_3800
Location
129024..129047 +
Type
RNA_hairpin
Sequence
GGTGCTGGAGGAGCAGGCAGCACC
Energy (kcal/mol)
-11.9908
Secondary Structure
View
 MyGBrowser