Feature RNA_hairpin_3796
Name
RNA_hairpin_3796
Location
128416..128436 +
Type
RNA_hairpin
Sequence
CGGTGAGCTTCCAGCTCGGCG
Energy (kcal/mol)
-8.9
Secondary Structure
View
 MyGBrowser