Feature RNA_hairpin_3795
Name
RNA_hairpin_3795
Location
128344..128373 +
Type
RNA_hairpin
Sequence
AAGCCACCCTGATCACCCCCGGGTTGGCTT
Energy (kcal/mol)
-13.5221
Secondary Structure
View
 MyGBrowser