Feature RNA_hairpin_3794
Name
RNA_hairpin_3794
Location
128191..128212 +
Type
RNA_hairpin
Sequence
ACCTCTCCGCTTACGGTGAGGT
Energy (kcal/mol)
-10.7
Secondary Structure
View
 MyGBrowser