Feature RNA_hairpin_3751
Name
RNA_hairpin_3751
Location
115322..115343 +
Type
RNA_hairpin
Sequence
GGCCTTGGTGGAAAACACGGCC
Energy (kcal/mol)
-10.1204
Secondary Structure
View
 MyGBrowser