Feature RNA_hairpin_3749
Name
RNA_hairpin_3749
Location
115266..115285 +
Type
RNA_hairpin
Sequence
GACCAAGCACTCGCCTGGTC
Energy (kcal/mol)
-10.1
Secondary Structure
View
 MyGBrowser